Heliothis virescens (Fabricius, 1777) and Helicoverpa zea (Boddie, 1850) (Lepidoptera: Noctuidae) Population on Transgenic and Non-Transgenic Cotton and their BT toxin resistance

D.C. Guzmán-Morales1; F. Castillo Reyes3; V. M. González-Vázquez1; O. García-Martínez2; L. A. Aguirre-Uribe2; M. A. Tiscareño-Iracheta4; C. N. Aguilar-González1; R. Rodríguez-Herrera1*

1. Departamento de investigación en Alimentos, Facultad de Ciencias Químicas de la Universidad Autónoma de Coahuila. Saltillo, Coahuila, México., Universidad Autónoma de Coahuila, Departamento de investigación en Alimentos, Facultad de Ciencias Químicas, Universidad Autónoma de Coahuila,

<city>Saltillo</city>
<state>Coahuila</state>
, Mexico , 2. Departamento de Parasitología Agrícola, Universidad Autónoma Agraria Antonio Narro. Buenavista, Saltillo, Coahuila, México., Universidad Autónoma Agraria Antonio Narro, Departamento de Parasitología Agrícola, Universidad Autónoma Agraria Antonio Narro,
<city>Saltillo</city>
<state>Coahuila</state>
, Mexico ,
3. Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Campo Experimental Saltillo, Saltillo, Coahuila, México., Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, Campo Experimental Saltillo,
<city>Saltillo</city>
<state>Coahuila</state>
, Mexico ,
4. Escuela de agronomía, Universidad Autónoma de San Luis Potosí. S.L.P. México., Escuela de agronomía, Universidad Autónoma de San Luis Potosí,
<state>S.L.P.</state>
, Mexico

Correspondence: *. Corresponding Author: Rodríguez-Herrera, R., Universidad Autónoma de Coahuila, Departamento de investigación en Alimentos, Facultad de Ciencias Químicas. Saltillo, Coahuila, México. E-mail: E-mail:


Abstract

In this study, the population dynamics of Helicoverpa zea and Heliothis virescens on transgenic and non-transgenic cotton cultivated in the Northern region of Mexico was determined. In order to perform this study, sampling of insects during the cotton phenological phases: floral bud, flowering, acorn formation, and opening was realized. In addition, the amplification of DNA regions encoding the glycosyltransferase to determine resistance to BT cotton was performed. Results showed that: in agricultural areas planted with transgenic cotton in Coahuila, H. virescens was not observed, however, the incidence of H. virescens was observed in transgenic cotton in Tamaulipas. This field incidence of H. virescens may be a consequence that the insect has developed resistance to Bt cotton. In addition, a higher allele diversity of the glycosyltransferase gene in H. virescens, when this insect was collected on transgenic cotton than those insects collected on non-transgenic cotton was determined.

Received: 2018 January 30; Accepted: 2018 June 22

revbio. 2020 Mar 23; 5(spe1): e441
doi: 10.15741/revbio.05.nesp.e441

Keywords: Key words: Transgenic-cotton, Lepidoptera, Bt toxin resistance.

Introduction

Cotton is susceptible to different insect pests among them: cotton weevil Anthonomus grandis (Firmino et al, 2013), Cotton stainers Dysdercus spp. (Shah 2014); red spider Tetranychus urticae (Guo et al., 2015), aphids Aphis gossypii (Ramalho et al., 2012), whitefly Bemisia tabaci (Ashfaq et al., 2014) and pink bollworm Pectinophora gossypiella (Tabashnik et al., 2002). Besides Lepidoptera Noctuidae, among them, cotton warbler Heliothis virescens (Blanco, 2012) and corn earworm Helicoverpa zea (Deplania et al., 2008) represent some of the most important pests in Mexico, due to the severity of the damage, wide distribution and diversity of crops attacked. The damage and behavior of both species are similar in cotton. H. virecens is capable of causing a 100 % loss in cotton by flower and acorn destruction, it can also attack tender portion of leaves and other vegetative parts of growth (Loera et al., 2008). In addition, H. virecens is difficult to control when attacking corn crops.

In Mexico, and especially in the La Laguna region for more than 12 years, several varieties of transgenic cotton have been cultivated, which have been planted in three quarters of the commercial lots, and the remaining area is planted with non-transgenic cotton, this circumstance undoubtedly implies an effect on the evolution of specific pest insect populations and could affect the genetic diversity of pest insects from other crops. The native varieties planted by the farmers constitute a reservoir of genes of world importance, but often, the production is not spectacular, their importance is that they retain valuable genetic information for resistance to pests and adverse environmental conditions (Diamond, 2002). Currently, the transgenic species increase their aptitude and therefore, they are being sown freely and there may be the possibility that they cross with native varieties, and it is possible that the native races are at risk of disappearance or of contamination with transgenic genes, which may affect in epistatic form to the host genome (Rissler & Mellon 1996; Turrent, 2010).

Coates et al. (2008) reported Bacillus thuringiensis endotoxin-resistant insects and notes that it is a great challenge for the use of these biopesticides. The majority of Bt resistance mechanisms in selected field populations or in the laboratory are due to recessive mutations that interfere with the activation of insect receptors. However, there are occasional examples of dominant or semi-dominant mechanisms with unusual characteristics. The mechanisms involved in resistance to Bt toxins are due to the loss of carbohydrate-glycolipids since Bt toxins bind directly and specifically to glycolipids, which makes this carbohydrate binding dependent and relevant for the in vivo action of the toxin (Griffitts et al., 2005). This loss of glycolipids has been associated with the loss of at least two genes encoding glycosyltransferases. These enzymes work in the intestine conferring susceptibility to the toxin (Griffitts et al., 2003). Under this perspective, studies to understand the dynamics of resistance development of insects to these transgenic plants are vital. The objectives of this work were: to determine the populations of Heliothis virescens and Helicoverpa zea associated with transgenic and non-transgenic cotton and identify the differences of the glycosyltransferase gene alleles that confer resistance to the Bacillus thuringiensis toxins in the insect (Heliothis virescens and Helicoverpa zea) cotton pests.

Material and Methods

Sampling sites

During the period from April 2011 to June 2012, field planted with transgenic cotton crop in three Mexican states were identified; 1) samples from Torreon, San Pedro de Las Colonias and Saltillo counties from the state of Coahuila, 2) samples from Rio Bravo, Tamaulipas; and 3) samples of non-transgenic cotton from the state of Chiapas were obtained. In all the sites (Table 1) the lepidoptera’s larva of Heliothis and Helicoverpa were collected through random sampling on plants from commercial fields. Some larvae were preserved in a plastic bottle with ethanol 70 %, and other larvae were allowed to continue their life cycle to corroborate their identification at the species level.

Table 1.

Lepidoptera parasitic in transgenic and non-transgenic cotton from different Mexican regions.


Region Specie Larvae Adults Cultivars
Coahuila H. zea 1 314 Transgenic cotton
Tamaulipas H. virescens 23 0 Transgenic cotton
H. zea 56 0 Transgenic cotton
Chiapas H. virescens 4 0 Non transgenic cotton

Taxonomic identification

Lepidoptera larvae were identified using the dichotomous key (Stehr, 2005). The larvae collected and maintained in alcohol were divided into two groups according to their morphological characteristics for identification of the corresponding specie. These larvae were then used for DNA isolation. On the other hand, the subgroup that was allowed to continue their life cycle was placed in plastic containers with moistened soil to promote their metamorphosis and complete the pupa phase until the adult stage under laboratory conditions, to corroborate their taxonomy at the level of specie.

DNA isolation

From each larva, a tissue sample (0.1 g) was used for DNA isolation. To remove ethanol from preservation, the larvae were placed on filter paper and for rapid alcohol evaporation, they were placed in a gas extraction hood for about 5 minutes or until the ethanol odor disappeared. Subsequently, a fragment from each larva was placed in liquid nitrogen for 12 hours. The insect tissue was macerated using an MP cell disruptor (6 m / s for 60 seconds) and the “D” MPbio matrix (FastPrep®). DNA isolation was performed using the AxyPrep Miniprep Genomic Blood DNA Kit procedure. DNA integrity was determined by gel electrophoresis on 1 % agarose. DNA quantification was performed on an Epoch™ brand plate reader BioTek microplate spectrophotometer with Take3 ™ model 8x2 and DNA quantification by the Gen5 1.11 program.

DNA amplification

Polymerase chain reaction (PCR) was performed to amplify the OnBreGalt5 (β-1, 3-Galactosylytransferase) gene using the primers pair: (Onb3GalT5-F1) (5’CGTGACAATGATGTCGTTCAA3’) and (Onb3GalT5-R1) (5’ TGCTGCGGCACTAAGCCCAC3’), which were previously designed by Coates et al. (2008). PCR was carried out in a final volume of 23 μL, integrated as follows: 14.5 μl of sterile deionized water, 2.5 μL of 10X buffer, 1 μL of MgCl2 (50 mM), 0.5 μL of dNTPs (10 mM), 2 μL of each primer (10 pmol), 0.5 μL of Taq polymerase (5 U/L) and 2 μL of the DNA sample (100 ng/L). The PCR amplification program was: denaturation at 95 °C for 2.5 min, hybridization at 69.7 °C for 0.30 minutes and polymerization at 72 °C for 1 minute for 40 cycles using a Px2 thermal cycling thermocycler. The amplified products were visualized by 1.5 % agarose gel electrophoresis. 100 bp ladder DNA marker (Invitrogen™) was used as a reference.

Statistical analysis

The amplified bands in each case were coded as presence (1) and absence (0). From the binary code matrix obtained, the following parameters were estimated: allele frequencies, genotype frequencies, population genetic balance, and Wright statistics (FIS, FIT and FST). We then used genetic parameters to compare intra-specie and inter-species diversity of the insect populations collected in transgenic and non-transgenic cotton. All analyzes were performed using the Genepop statistical package (4.0.10).

Results and Discussion

Insect species collected

From the 12 years that Bt transgenic cotton has been cultivated in the La Laguna, Coahuila and North Tamaulipas, these type of cotton has covered – parts of the cultivated area, and to date, there has been no information on the population dynamics of Heliothis virescens and their resistance evolution to Bt plants over time, which could certainly have affected insect populations. For the specific case of La Laguna, in Table 1, it was not possible to collect H. virescens attacking the cotton, which is what would be expected, but it was possible to capture H. virescens when the sex pheromone was used, indicating that the primary insect was present in the growing area. However, it was possible to collect Helicoverpa zea that traditionally attacks corn in cotton orchards at very low density.

For the Northern region of Tamaulipas, it was possible to detect both species Heliothis virescens and H. zea, although in different proportions (Table 1). The proportion of H. zea is higher than that of H. virescens, this presence in transgenic cotton implies that the population of H. virescens has modified its genetic structure due to the selection pressure of maize-cotton. These differences in the presence of H. virescens in cotton in both regions can be explained by the fact that maize plays an important role as a secondary host by acting as a pressure factor. For the case of La Laguna, maize is mainly for forage purposes, which implies that it is harvested in an immature state for its silage and this prevents that the insect biological cycle is completed, in contrast in the North of Tamaulipas, corn is produced for grain obtaining, what of certainly helps the insect to complete its biological cycle and then field is used to grow cotton. This behavior could be the reason that H. virescens is generating resistance when feeding on transgenic maize and later on transgenic cotton.

The absence of insect species in plants due to the toxicity of Cry 1Ab protein has already been reported by Flint et al. (1996) who observed a reduction in the infestation of P. gossypiella pinkworm larvae on transgenic cotton lines in contrast to non-transgenic lines. The reduction varied from 93 to almost 100 % and reflects the condition present in the lines containing the Bollgard gene and is highly resistant to this pest. In the same trend, Henneberry & Forlow (2000) determined survival of P. gossypiella larvae less than 0.1 cm in transgenic cotton lines.

Although initially, the introduction of a transgenic gene for insect resistance may be effective, Flint et al. (1996) demonstrated that the number of P. gossypiella larvae of the fourth instar was practically zero in fields planted with transgenic cotton which have the Bollgard gene, but not in control plants. Over time and if producers do not have proper handling, resistance to insects can be overwhelmed by the evolution of genes for resistance in insects towards that transgenic gene.

Allelic Diversity

Through PCR different bands were amplified as potential genes encoding glycosyltransferase. It was possible to amplify a greater number of DNA bands of Heliothis virescens collected from transgenic cotton compared to non-transgenic cotton (Table 2), this may be due to mutations occurred when these insects were subjected to a selection pressure when feeding on transgenic tissue. On the other hand, it is interesting to note that only in DNA from insects found in transgenic cotton was it possible to amplify two bands with a molecular weight of 450 and 600 bp (Figure 1), which shows that there are regions of DNA in the genome of H. virescens that could code for proteins conferring Bt resistance.

Table 2.

Amplified bands by PCR from genes encoding glycosyltransferases from Heliothis virescens larvae and adults.


Alleles Transgenic cotton Non-transgenic cotton
Frequency FIS frequency FIS
350 0.2333 -0.2727 0.5000 -1.0000
400 0.5333 -0.5849 0.5000 -1.0000
450 0.2000 -0.2174
600 0.03333 0.0000
Total -0.3684 -1.0000


[Figure ID: f1] Figure 1.

DNA amplicons obtained with OnBreGalt5 primers in samples collected in a transgenic cotton plant. M: 100 bp marker, (-) negative control, (+) positive control, Lane 3: 31-2, Coahuila. Lane 5: 63-1, Tamaulipas. Lane 6: 59-2, Ta-maulipas. Lane 9: 89-4, Tamaulipas.


For Helicoverpa zea a higher amplification pattern was observed in contrast to H. virescens when DNA was obtained from insect attacking directly to transgenic cotton (Table 3). The fragments amplified for the glycosyltransferases gene could be correlated with the presence of sequences in the insects, thus presenting a greater synthesis of proteins that inhibit the effect of the biological insecticide, and therefore a greater tolerance and consumption of plant tissue.

Table 3.

Amplified bands by PCR from genes encoding glycosyltransferases from Heliothis virescens larvae and adults and their FIS value.


Alleles Transgenic cotton
Frequency FIS
250 0.2576 0.9231
300 0.0303 -0.0159
350 0.2576 -0.1736
400 0.2727 -0.0541
450 0.0909 -0.0847
600 0.0909 -0.0847
Total 0.1554

Hardy-Weinberg Model

Table 4 shows the frequency of homozygotes and heterozygotes in the Heliothis virescens and Helicoverpa zea populations collected from transgenic cotton and showing that there is a tendency for an excess of heterozygotes and a deficiency of homozygotes. One possible explanation may be due to the reproductive isolation to which these populations have been subjected and which implies that there is no random crossing between individuals or by selective pairing. Checa et al. (1998) points out that the cause of the increase in homozygosity is due to genes involved in the character being selected and genes that are in linkage disequilibrium with them. Another possible cause could be small population size or sampling-related effects (genetic drift) and can be measured using the FSI statistic (Cañon et al., 2007).

Table 4.

Observed and expected frequency of homozygotes and heterozygotes under the Hardy-Weinberg model in Helicoverpa zea and Heliothis virescens sampled in transgenic cotton.


Region Population Specie Homozygotes Heterozygotes
E O E O
La Laguna Ávila Camacho TC HZ 5.2609 2 6.7391 10
Ejido la Fe TC HZ 0.3333 0 1.6667 2
Tamaulipas Field 1 TC HV 3.0588 0 5.9412 9
Field 2 TC HZ 4.9189 9 14.0811 10
Field 3 TC HV 2.1818 2 3.8182 4

TFN1TC = transgenic cotton, NTC = non transgenic cotton, HV = Heliothis virescens, HZ = Heliothis zea.


Wright statistics

The genetic structure of the two insect species was inferred by the Wright F statistics (FIT, FST, and FIS) (Wright, 1978) in each of the sampled insect populations. The FIS values in the insect populations collected on transgenic cotton were negative except for the transgenic cotton population obtained from Tamaulipas. In this case, FIS estimates the deficiency of heterozygotes as consequence of the reproductive isolation, which entails a non-random cross-breeding of individuals, that is, it measures the inbreeding coefficient and values can range from 0 to 1 (Checa et al., 1998). Therefore, the data suggest that the insect populations collected in Tamaulipas transgenic cotton might be that there is no random mating or that this result is a selection effect of individuals who present tolerance to the biological insecticide produced by the transgenic plants, since the more susceptible die and those with the tolerance gene survive (Table 5).

Table 5.

Wright statistics in Helicoverpa zea and Heliothis virescens populations collected on transgenic cotton.


Wright Parameter
Population FIS FST FIT
Chiapas NTC -1.000000
Ávila Camacho TC (Coahuila) -0.517241
Ejido la Fe TC (Coahuila) -0.333333
Sitio 1 TC (Tamaulipas) -0.565217
Sitio 3 TC (Tamaulipas) 0.289641 0.189687 0.373183

TFN2TC = transgenic cotton, NTC = non transgenic cotton


The negative values of the populations (Table 5) indicate higher levels of observed heterozygosity than expected under equilibrium, which may be a consequence of the so-called Wahlund effect, as a result of recent crosses between animals belonging to genetically different lines or these excesses of heterozygotes could be the result of negative associative mating (Cañon et al., 2007).

Conclusions

It was possible to determine the diversity of the alleles, in which a greater variation in the H. virescens species was observed when insects from the transgenic cotton plants were compared with those from the non-transgenic cotton, the variation is attributed to possible mutations that arise by the selection pressure on Bt toxins-transgenic cottons. This was corroborated by the greater number of genome sequences observed from the transgenic cotton crop represented by specific fragments of 450 and 600 bp.


fn1Cite this paper: Guzmán-Morales, D. C., Castillo Reyes, F., González-Vázquez, V. M., García -Martínez, O., Aguirre-Uribe, L. A., Tiscareño-Iracheta, M. A., Aguilar-González, C. N., Rodríguez -Herrera, R. (2018). Heliothis virescens (Fabricius, 1777) and Helicoverpa zea (Boddie, 1850) (Lepidoptera: Noctuidae) Population on Transgenic and Non-Transgenic Cotton and their BT toxin resistance. Revista Bio Ciencias 5(nesp), e441. doi: https://doi.org/10.15741/revbio.05.nesp.e441

Referencias
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.

Enlaces refback

  • No hay ningún enlace refback.


Revista Bio Ciencias, Año 12, vol. 8,  Enero 2021. Sistema de Publicación Continua editada por la Universidad Autónoma de Nayarit. Ciudad de la Cultura “Amado Nervo”,  Col. Centro,  C.P.: 63000, Tepic, Nayarit, México. Teléfono: (01) 311 211 8800, ext. 8922. E-mail: revistabiociencias@gmail.com, revistabiociencias@yahoo.com.mx, http://revistabiociencias.uan.mx. Editor responsable: Dr. Manuel Iván Girón Pérez. No. de Reserva de derechos al uso exclusivo 04-2010-101509412600-203, ISSN 2007-3380, ambos otorgados por el Instituto Nacional de Derechos de Autor. Responsable de la última actualización de este número Dr. Manuel Iván Girón Pérez. Secretaria de Investigación y Posgrado, edificio Centro Multidisciplinario de Investigación Científica (CEMIC) 03 de la Universidad Autónoma de Nayarit. La opinión expresada en los artículos firmados es responsabilidad del autor. Se autoriza la reproducción total o parcial de los contenidos e imágenes, siempre y cuando se cite la fuente y no sea con fines de lucro.

Licencia Creative Commons
Revista Bio Ciencias por Universidad Autónoma de Nayarit se encuentra bajo una licencia de Creative Commons Reconocimiento-NoComercial-SinObraDerivada 4.0 Internacional

Fecha de última actualización 03 de Noviembre de 2021

 

licencia de Creative Commons Reconocimiento-NoComercial-SinObraDerivada 4.0 Internacional